Exempel på misstänkta frågor

Vi står till ert fulla förfogande när det gäller nyfikenhetsfrågor, men i vårt uppdrag ingår inte att tillhandahålla läxhjälp. Därför besvarar vi inte frågor som vi bedömer vara skoluppgifter. Här är några exempel:

Fråga 1: En DNA-sekvens ser ut på följande sätt: 5’GTGTTACCTCGTGCAGTTCATAGTT3′

DNA-sekvensen styr bildningen av början på en peptidkedja. Hur ser den ut? Ledning: Börja avläsningen med startkodon, dvs. AUG.

Fråga 2: Vad händer med äggvita om den: 1. Fryses och sedan tinas; 2. Blandas med hett vatten; 3. Blandas med hett vatten och NaOH;  4. Blandas med rödsprit; 5. Blandas med diskmedel; 6. Blandas med vinsyra; 7. Blandas med koksalt?

Fråga 3: Varför blir det oftast balans mellan mängden växter, växtätare, och rovdjur i ett ekoystem?

augusti 28, 2013

Inlägget postades i

Okategoriserade